Mature sequence osa-miR167a-5p

Accession numberMIMAT0000641
IDosa-miR167a-5p
Previous IDsosa-miR167a
Stem-Loop osa-MIR167a
Sequence
ugaagcugccagcaugaucua
Get sequence
Deep sequencing86656 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).