Mature mmu-miR-211-5p
| Accession | MIMAT0000668 |
| Description | mmu-miR-211-5p mature miRNA |
| Hairpins | |
| Sequence | UUCCCUUUGUCAUCCUUUGCCU |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28901393 | has_input UniProtKB:O08538 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28901393 | has_input UniProtKB:O08538 |
| involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28901393 |
