Accession | MIMAT0000674 |
Description | mmu-miR-181c-5p mature miRNA |
Hairpins | |
Sequence | AACAUUCAACCUGUCGGUGAGU |
Evidence |
experimental
cloned [2-3], Illumina [4,6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22950459 | has_input UniProtKB:P06804 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23650073 | has_input UniProtKB:Q9Z2D6 |
involved_in | GO:0001774 microglial cell activation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22950459 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22950459 | has_input UniProtKB:P06804 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23650073 | has_input UniProtKB:Q9Z2D6 |
involved_in | GO:0043524 negative regulation of neuron apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22950459 | |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23650073 | |
involved_in | GO:0061889 negative regulation of astrocyte activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23650073 |