Accession | MIMAT0000677 |
Description | mmu-miR-7a-5p mature miRNA |
Hairpins | |
Sequence | UGGAAGACUAGUGAUUUUGUUGU |
Evidence |
experimental
cloned [2,4], Illumina [5-6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | has_input UniProtKB:Q60644 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | has_input UniProtKB:P15208 |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 |