Accession | MIMAT0000690 |
Description | hsa-miR-296-5p mature miRNA |
Hairpins | |
Sequence | AGGGCCCCCCCUCAAUCCUGU |
Evidence |
experimental
cloned [2,4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18977327 | has_input UniProtKB:O14964 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | has_input UniProtKB:P08138 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | has_input UniProtKB:Q14790 |
involved_in | GO:0010641 positive regulation of platelet-derived growth factor receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18977327 | occurs_in CL:2000044 |
involved_in | GO:0030335 positive regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | |
involved_in | GO:0030949 positive regulation of vascular endothelial growth factor receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18977327 | occurs_in CL:2000044 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18977327 | occurs_in CL:2000044 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | has_input UniProtKB:P08138 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927008 | has_input UniProtKB:Q14790 |
involved_in | GO:0090050 positive regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18977327 | occurs_in CL:2000044 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|