Mature sequence rno-miR-7b

Accession numberMIMAT0000780
IDrno-miR-7b
Stem-Loop rno-mir-7b
Sequence
uggaagacuugugauuuuguugu
Get sequence
Deep sequencing50144 reads, 458 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).