Mature sequence rno-miR-192-5p

Accession numberMIMAT0000867
IDrno-miR-192-5p
Previous IDsrno-miR-192
Stem-Loop rno-mir-192
Sequence
cugaccuaugaauugacagcc
Get sequence
Deep sequencing42705016 reads, 508 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).