Mature sequence rno-miR-194-5p

Accession numberMIMAT0000869
IDrno-miR-194-5p
Previous IDsrno-miR-194
Stem-Loop rno-mir-194-1 rno-mir-194-2
Sequence
uguaacagcaacuccaugugga
Get sequence
Deep sequencing5106761 reads, 501 experiments
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).