Mature sequence rno-miR-214-3p

Accession numberMIMAT0000885
IDrno-miR-214-3p
Previous IDsrno-miR-214
Stem-Loop rno-mir-214
Sequence
acagcaggcacagacaggcag
Get sequence
Deep sequencing61382 reads, 469 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).