Mature sequence rno-miR-217-5p

Accession numberMIMAT0000887
IDrno-miR-217-5p
Previous IDsrno-miR-217
Stem-Loop rno-mir-217
Sequence
uacugcaucaggaacugacugg
Get sequence
Deep sequencing268028 reads, 302 experiments
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).