Mature sequence rno-miR-219a-5p

Accession numberMIMAT0000889
IDrno-miR-219a-5p
Previous IDsrno-miR-219
Stem-Loop rno-mir-219a-1 rno-mir-219a-2
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing64975 reads, 372 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).