Mature sequence rno-miR-291a-3p

Accession numberMIMAT0000895
IDrno-miR-291a-3p
Previous IDsrno-miR-291-3p
Stem-Loop rno-mir-291a
Sequence
aaagugcuuccacuuugugugcc
Get sequence
Deep sequencing338 reads, 67 experiments
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).