Mature sequence osa-miR393a

Accession numberMIMAT0000957
IDosa-miR393a
Previous IDsosa-miR393
Stem-Loop osa-MIR393a
Sequence
uccaaagggaucgcauugauc
Get sequence
Deep sequencing176 reads, 2 experiments
Database links
QuickGO function

References

1