Mature sequence osa-miR399c

Accession numberMIMAT0000986
IDosa-miR399c
Stem-Loop osa-MIR399c
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing6 reads, 2 experiments
Database links
QuickGO function

References

1