Mature sequence osa-miR399f

Accession numberMIMAT0000989
IDosa-miR399f
Stem-Loop osa-MIR399f
Sequence
ugccaaaggagauuugcccag
Get sequence
Deep sequencing7 reads, 2 experiments

References

1