Mature sequence osa-miR399k

Accession numberMIMAT0000994
IDosa-miR399k
Stem-Loop osa-MIR399k
Sequence
ugccaaaggaaauuugccccg
Get sequence
Deep sequencing reads, experiments

References

1