Mature sequence ath-miR319c

Accession numberMIMAT0001016
IDath-miR319c
Stem-Loop ath-MIR319c
Sequence
uuggacugaagggagcuccuu
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).