Mature sequence osa-miR159f

Accession numberMIMAT0001027
IDosa-miR159f
Stem-Loop osa-MIR159f
Sequence
cuuggauugaagggagcucua
Get sequence
Deep sequencing1781 reads, 2 experiments
Database links
QuickGO function

References

1