Mature sequence osa-miR160e-5p

Accession numberMIMAT0001030
IDosa-miR160e-5p
Previous IDsosa-miR160e
Stem-Loop osa-MIR160e
Sequence
ugccuggcucccuguaugccg
Get sequence
Deep sequencing519 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).