Mature sequence osa-miR169d

Accession numberMIMAT0001049
IDosa-miR169d
Stem-Loop osa-MIR169d
Sequence
uagccaaggaugaauugccgg
Get sequence
Deep sequencing1233 reads, 2 experiments

References

1