Mature sequence osa-miR169g

Accession numberMIMAT0001052
IDosa-miR169g
Stem-Loop osa-MIR169g
Sequence
uagccaaggaugacuugccua
Get sequence
Deep sequencing5696 reads, 2 experiments
Database links
QuickGO function

References

1