Mature sequence osa-miR166g-3p

Accession number MIMAT0001072
ID osa-miR166g-3p
Previous IDs osa-miR166g
Sequence
ucggaccaggcuucauuccuc
Get sequence
Stem-Loop osa-MIR166g

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).