Mature sequence gga-miR-124a-3p

Accession numberMIMAT0001128
IDgga-miR-124a-3p
Stem-Loop gga-mir-124a gga-mir-124a-2
Sequence
uuaaggcacgcggugaaugcca
Get sequence
Deep sequencing364040 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).