Mature sequence gga-miR-194

Accession numberMIMAT0001133
IDgga-miR-194
Stem-Loop gga-mir-194
Sequence
uguaacagcaacuccaugugga
Get sequence
Deep sequencing216 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).