Mature sequence gga-let-7d

Accession numberMIMAT0001161
IDgga-let-7d
Stem-Loop gga-let-7d
Sequence
agagguaguggguugcauagu
Get sequence
Deep sequencing15478 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).