Mature sequence dps-miR-1

Accession numberMIMAT0001199
IDdps-miR-1
Stem-Loop dps-mir-1
Sequence
uggaauguaaagaaguauggag
Get sequence
Deep sequencing reads, experiments

References