Mature sequence dps-miR-2b

Accession numberMIMAT0001201
IDdps-miR-2b
Stem-Loop dps-mir-2b-1 dps-mir-2b-2
Sequence
uaucacagccagcuuugaggagc
Get sequence
Deep sequencing reads, experiments

References