Mature sequence dps-miR-184

Accession numberMIMAT0001232
IDdps-miR-184
Stem-Loop dps-mir-184
Sequence
uggacggagaacugauaagggc
Get sequence
Deep sequencing reads, experiments

References