Mature sequence dre-miR-182-3p

Accession numberMIMAT0001272
IDdre-miR-182-3p
Previous IDsdre-miR-182*
Stem-Loop dre-mir-182
Sequence
ugguucuagacuugccaacua
Get sequence
Deep sequencing12 reads, 6 experiments

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).