Mature sequence xla-miR-427

Accession numberMIMAT0001344
IDxla-miR-427
Stem-Loop xla-mir-427
Sequence
aaagugcuuucuguuuuuggcg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).