Mature sequence xla-miR-20

Accession numberMIMAT0001348
IDxla-miR-20
Sequence
caaagugcucauagugcagguag
Get sequence
Stem-Loop xla-mir-20

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).