Mature sequence xla-miR-18a-5p

Accession numberMIMAT0001349
IDxla-miR-18a-5p
Stem-Loop xla-mir-18a-1 xla-mir-18a-2
Sequence
uaaggugcaucuagugcaguuag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).
2
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).