Mature sequence gga-miR-20b-5p

Accession numberMIMAT0001411
IDgga-miR-20b-5p
Stem-Loop gga-mir-20b
Sequence
caaagugcucauagugcagguag
Get sequence
Deep sequencing20904 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15590942 "Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags" Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER, Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE, Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J, Genome Res. 15:174-183(2005).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).