Mature sequence dre-miR-430a-3p

Accession numberMIMAT0001423
IDdre-miR-430a-3p
Previous IDsdre-miR-430a
Sequence
uaagugcuauuuguugggguag
Get sequence
Stem-Loop dre-mir-430a-1 dre-mir-430a-2 dre-mir-430a-3 dre-mir-430a-4 dre-mir-430a-5 dre-mir-430a-6 dre-mir-430a-7 dre-mir-430a-8 dre-mir-430a-9 dre-mir-430a-10 dre-mir-430a-11 dre-mir-430a-12 dre-mir-430a-13 dre-mir-430a-14 dre-mir-430a-15 dre-mir-430a-16 dre-mir-430a-17 dre-mir-430a-18

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).