Mature sequence dre-miR-430b-3p

Accession numberMIMAT0001424
IDdre-miR-430b-3p
Previous IDsdre-miR-430b
Stem-Loop dre-mir-430b-1 dre-mir-430b-2 dre-mir-430b-3 dre-mir-430b-4 dre-mir-430b-6 dre-mir-430b-7 dre-mir-430b-8 dre-mir-430b-9 dre-mir-430b-10 dre-mir-430b-11 dre-mir-430b-12 dre-mir-430b-13 dre-mir-430b-14 dre-mir-430b-15 dre-mir-430b-16 dre-mir-430b-17 dre-mir-430b-18 dre-mir-430b-5 dre-mir-430b-19 dre-mir-430b-20
Sequence
aaagugcuaucaaguugggguag
Get sequence
Deep sequencing reads, experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).