Mature sequence aga-miR-125

Accession numberMIMAT0001500
IDaga-miR-125
Stem-Loop aga-mir-125
Sequence
ucccugagacccuaacuuguga
Get sequence
Deep sequencing reads, experiments

References