Mature sequence rno-miR-429

Accession numberMIMAT0001538
IDrno-miR-429
Stem-Loop rno-mir-429
Sequence
uaauacugucugguaaugccgu
Get sequence
Deep sequencing652485 reads, 460 experiments
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2