Mature sequence rno-miR-449a-5p

Accession numberMIMAT0001543
IDrno-miR-449a-5p
Previous IDsrno-miR-449;rno-miR-449a
Stem-Loop rno-mir-449a
Sequence
uggcaguguauuguuagcuggu
Get sequence
Deep sequencing45893 reads, 391 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).