Mature sequence rno-miR-365-3p

Accession numberMIMAT0001549
IDrno-miR-365-3p
Previous IDsrno-miR-365
Stem-Loop rno-mir-365
Sequence
uaaugccccuaaaaauccuuau
Get sequence
Deep sequencing32148 reads, 481 experiments
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).