Mature sequence osa-miR390-5p

Accession numberMIMAT0001588
IDosa-miR390-5p
Previous IDsosa-MIR390;osa-miR390
Stem-Loop osa-MIR390
Sequence
aagcucaggagggauagcgcc
Get sequence
Deep sequencing466 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).