Mature sequence dre-miR-16a

Accession numberMIMAT0001774
IDdre-miR-16a
Stem-Loop dre-mir-16a
Sequence
uagcagcacguaaauauuggug
Get sequence
Deep sequencing23349 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).