Mature sequence dre-miR-18b-5p

Accession numberMIMAT0001780
IDdre-miR-18b-5p
Previous IDsdre-miR-18b
Stem-Loop dre-mir-18b
Sequence
uaaggugcauuuagugcagaua
Get sequence
Deep sequencing4627 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).