Mature sequence dre-miR-22a-3p

Accession numberMIMAT0001788
IDdre-miR-22a-3p
Previous IDsdre-miR-22a
Stem-Loop dre-mir-22a
Sequence
aagcugccagcugaagaacugu
Get sequence
Deep sequencing210847 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).