Mature sequence dre-miR-26b

Accession numberMIMAT0001795
IDdre-miR-26b
Stem-Loop dre-mir-26b
Sequence
uucaaguaauccaggauagguu
Get sequence
Deep sequencing273056 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).