Mature sequence dre-miR-148

Accession numberMIMAT0001845
IDdre-miR-148
Stem-Loop dre-mir-148
Sequence
ucagugcauuacagaacuuugu
Get sequence
Deep sequencing10860 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).