Mature sequence dre-miR-194b

Accession numberMIMAT0001859
IDdre-miR-194b
Stem-Loop dre-mir-194b
Sequence
uguaacagccgcuccaugugga
Get sequence
Deep sequencing207 reads, 8 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).