Mature sequence dre-miR-218b

Accession numberMIMAT0001869
IDdre-miR-218b
Stem-Loop dre-mir-218b
Sequence
uugugcuugaucuaaccaugca
Get sequence
Deep sequencing1844 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).