Mature sequence dre-miR-338

Accession numberMIMAT0001873
IDdre-miR-338
Stem-Loop dre-mir-338-1 dre-mir-338-2
Sequence
uccagcaucagugauuuuguug
Get sequence
Deep sequencing17134 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).