Mature sequence dre-miR-458-3p

Accession numberMIMAT0001885
IDdre-miR-458-3p
Previous IDsdre-miR-458
Stem-Loop dre-mir-458
Sequence
auagcucuuugaaugguacugc
Get sequence
Deep sequencing4726 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).