Mature sequence kshv-miR-K12-2-5p

Accession numberMIMAT0002183
IDkshv-miR-K12-2-5p
Previous IDskshv-miR-K12-2
Sequence
aacuguaguccgggucgaucug
Get sequence
Stem-Loop kshv-miR-K12-2

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
3
4
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).